Stem-loop sequence zma-MIR528a

AccessionMI0013239 (change log)
DescriptionZea mays miR528a stem-loop
Gene family MIPF0000868; MIR528
Literature search

19 open access papers mention zma-MIR528a
(121 sentences)

Stem-loop
   -            u   g     g  cac   c    uguggcuggaagaagcagccggggcc 
5'  guggaaggggca gca aggag ag   gag gagg                          u
    |||||||||||| ||| ||||| ||   ||| ||||                           
3'  uaccuucuccgu cgu uccuc uc   cuc cucc                          g
   u            c   g     -  ---   a    ucucgaacgcuccccauauaucgugu 
Get sequence
Deep sequencing
5027 reads, 1.74e+03 reads per million, 185 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 6412284-6412406 [+]
intergenic
Database links

Mature sequence zma-miR528a-5p

Accession MIMAT0014028
Previous IDszma-miR528a
Sequence

2 - 

uggaaggggcaugcagaggag

 - 22

Get sequence
Deep sequencing3616 reads, 141 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR528a-3p

Accession MIMAT0015362
Previous IDszma-miR528a*
Sequence

103 - 

ccugugccugccucuuccauu

 - 123

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).