Stem-loop sequence zma-MIR482

AccessionMI0013238 (change log)
DescriptionZea mays miR482 stem-loop
Literature search

6 open access papers mention zma-MIR482
(14 sentences)

Stem-loop
   --        - ug      ccuu  --au   --u   accgccggaggagcgcucgccuucu 
5'   agugggag a  aaggag    gc    cga   guc                         u
     |||||||| |  ||||||    ||    |||   |||                         c
3'   uuacccuc u  uuccuu    cg    gcu   cag                         g
   uu        c ug      --cu  cucc   ccc   gcucccgccgauaacgccgccacgc 
Get sequence
Deep sequencing
738 reads, 869 reads per million, 151 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
LPUQ01000192.1: 319480-319601 [+]
intergenic
Database links

Mature sequence zma-miR482-5p

Accession MIMAT0015361
Previous IDszma-miR482*
Sequence

3 - 

ugggagaugaaggagccuu

 - 21

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence not experimental

Mature sequence zma-miR482-3p

Accession MIMAT0014027
Previous IDszma-miR482
Sequence

101 - 

ucuuccuuguuccucccauu

 - 120

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).