Stem-loop sequence zma-MIR408b

AccessionMI0013237 (change log)
DescriptionZea mays miR408b stem-loop
Gene family MIPF0000102; MIR408
Literature search

22 open access papers mention zma-MIR408b
(135 sentences)

Stem-loop
   --ga      c       a   u   u       cau    agaauuccaaauuugauuucuguuugcucgcuc 
5'     caggga gaggcag gca ggg agggggc   caac                                 a
       |||||| ||||||| ||| ||| |||||||   ||||                                 c
3'     gucccu cuccguc cgu ccc ucccucg   guug                                 a
   cucg      u       a   c   -       -uu    cggacucacacaaacaccacucagggagguaaa 
Get sequence
Deep sequencing
758 reads, 703 reads per million, 164 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 39583938-39584084 [-]
intergenic
Database links

Mature sequence zma-miR408b-5p

Accession MIMAT0015360
Previous IDszma-miR408b*
Sequence

3 - 

cagggacgaggcagagcaugg

 - 23

Get sequence
Deep sequencing231 reads, 115 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR408b-3p

Accession MIMAT0014026
Previous IDszma-miR408b
Sequence

125 - 

cugcacugccucuucccuggc

 - 145

Get sequence
Deep sequencing184 reads, 20 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).