Stem-loop sequence zma-MIR399j

AccessionMI0013236 (change log)
DescriptionZea mays miR399j stem-loop
Gene family MIPF0000015; MIR399
Literature search

22 open access papers mention zma-MIR399j
(66 sentences)

Stem-loop
   ---a            c       - ag       gucaucgucgccaucgacgacgguugcuuggcucugcuaugcuguguucguuc 
5'     ggcagcucuccu uggcagg c  gcgcgcg                                                     g
       |||||||||||| ||||||| |  |||||||                                                     u
3'     ccguugagagga accgucc g  ugcgcgc                                                     c
   cguc            a       u ca       acguacgugcguacaaugugacguuacguacgugccgaucgaucgugugguac 
Get sequence
Deep sequencing
2553 reads, 1.62e+03 reads per million, 163 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr9: 24309478-24309652 [-]
intergenic
Database links

Mature sequence zma-miR399j-5p

Accession MIMAT0015359
Previous IDszma-miR399j*
Sequence

1 - 

aggcagcucuccucuggcagg

 - 21

Get sequence
Deep sequencing102 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR399j-3p

Accession MIMAT0014025
Previous IDszma-miR399j
Sequence

154 - 

ugccaaaggagaguugcccug

 - 174

Get sequence
Deep sequencing657 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).