Stem-loop sequence zma-MIR399i

AccessionMI0013235 (change log)
DescriptionZea mays miR399i stem-loop
Gene family MIPF0000015; MIR399
Literature search

22 open access papers mention zma-MIR399i
(65 sentences)

Stem-loop
   --  u           c      gag    cgacu    -   ac   c 
5'   ag gcggcucuccu uggcau   ggcg     gaga ggc  gaa a
     || ||||||||||| ||||||   ||||     |||| |||  |||  
3'   uc cguugagagga accgua   ccgu     cucu ccg  cuu g
   cg  c           a      --a    ----c    u   gu   u 
Get sequence
Deep sequencing
2021 reads, 666 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 150372041-150372131 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR399i
zma-MIR399hchr5: 150363095-150363188 [+]
zma-MIR399ichr5: 150372041-150372131 [+]
Database links

Mature sequence zma-miR399i-5p

Accession MIMAT0015358
Previous IDszma-miR399i*
Sequence

2 - 

gugcggcucuccucuggcaug

 - 22

Get sequence
Deep sequencing776 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR399i-3p

Accession MIMAT0014024
Previous IDszma-miR399i
Sequence

70 - 

ugccaaaggagaguugcccug

 - 90

Get sequence
Deep sequencing656 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).