Stem-loop sequence zma-MIR399h

AccessionMI0013234 (change log)
DescriptionZea mays miR399h stem-loop
Gene family MIPF0000015; MIR399
Literature search

23 open access papers mention zma-MIR399h
(67 sentences)

Stem-loop
   --  u           c     -c   ccaa     -a -ca   u   c 
5'   ag gcaguucuccu uggca  gaa    ggcug  g   gcu gcc c
     || ||||||||||| |||||  |||    |||||  |   ||| |||  
3'   uc cguuaagagga accgu  cuu    ccggc  c   cga cgg a
   cg  c           a     uc   ---c     ag acc   u   u 
Get sequence
Deep sequencing
1143 reads, 738 reads per million, 21 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 150363095-150363188 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR399h
zma-MIR399hchr5: 150363095-150363188 [+]
zma-MIR399ichr5: 150372041-150372131 [+]
Database links

Mature sequence zma-miR399h-5p

Accession MIMAT0015357
Previous IDszma-miR399h*
Sequence

2 - 

gugcaguucuccucuggcacg

 - 22

Get sequence
Deep sequencing501 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR399h-3p

Accession MIMAT0014023
Previous IDszma-miR399h
Sequence

73 - 

ugccaaaggagaauugcccug

 - 93

Get sequence
Deep sequencing603 reads, 8 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).