Stem-loop sequence zma-MIR399g

AccessionMI0013233 (change log)
DescriptionZea mays miR399g stem-loop
Gene family MIPF0000015; MIR399
Literature search

22 open access papers mention zma-MIR399g
(67 sentences)

Stem-loop
   --a      cc    g        ----ugcg   g 
5'    gggcaa  cccc uuggcagg        acg c
      ||||||  |||| ||||||||        |||  
3'    cccguu  gggg aaccgucc        ugc g
   cgg      ua    a        caucccca   a 
Get sequence
Deep sequencing
874 reads, 846 reads per million, 147 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 233618406-233618473 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR399g
zma-MIR399achr4: 233617206-233617328 [-]
zma-MIR399gchr4: 233618406-233618473 [+]
Database links

Mature sequence zma-miR399g-5p

Accession MIMAT0015356
Previous IDszma-miR399g*
Sequence

2 - 

gggcaaccccccguuggcagg

 - 22

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR399g-3p

Accession MIMAT0014022
Previous IDszma-miR399g
Sequence

47 - 

ugccaaaggggauuugcccgg

 - 67

Get sequence
Deep sequencing74 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).