Stem-loop sequence zma-MIR398b

AccessionMI0013232 (change log)
DescriptionZea mays miR398b stem-loop
Gene family MIPF0000871; MIR398_2
Literature search

16 open access papers mention zma-MIR398b
(63 sentences)

Stem-loop
   --       ga             ggaaugaga        u   u  g   u  u   c 
5'   gggggcg  cugggaacacaug         ugagauca ugc cg ucg gc ggc u
     |||||||  |||||||||||||         |||||||| ||| || ||| || |||  
3'   cccccgc  gacucuuguguac         guucuagu gcg gc ggc ug ccg g
   gg       ug             ---------        u   c  -   -  -   g 
Get sequence
Deep sequencing
2547 reads, 2.33e+03 reads per million, 184 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 39887938-39888045 [+]
intergenic
Database links

Mature sequence zma-miR398b-5p

Accession MIMAT0015355
Previous IDszma-miR398b*
Sequence

2 - 

ggggcggacugggaacacaug

 - 22

Get sequence
Deep sequencing22 reads, 11 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR398b-3p

Accession MIMAT0014021
Previous IDszma-miR398b
Sequence

87 - 

uguguucucaggucgcccccg

 - 107

Get sequence
Deep sequencing27 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).