Stem-loop sequence zma-MIR398a

AccessionMI0013231 (change log)
DescriptionZea mays miR398a stem-loop
Gene family MIPF0000871; MIR398_2
Literature search

15 open access papers mention zma-MIR398a
(58 sentences)

Stem-loop
   ------------gggggcgaacugagaacacaugagaaua ug       auugcuc  cu  -    ac      u c 
5'                                         a  agaugag       gc  cg cggu  gguucg g u
                                           |  |||||||       ||  || ||||  |||||| |  
3'                                         u  ucuacuu       cg  gc gcca  ccaggu c g
   cgcccccgcuggacucuuguguacgucguaauaauacgca gu       -----gc  cu  u    --      c g 
Get sequence
Deep sequencing
1453 reads, 1.34e+03 reads per million, 154 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 174319898-174320037 [+]
intergenic
Database links

Mature sequence zma-miR398a-5p

Accession MIMAT0015354
Previous IDszma-miR398a*
Sequence

2 - 

ggggcgaacugagaacacaug

 - 22

Get sequence
Deep sequencing18 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR398a-3p

Accession MIMAT0014020
Previous IDszma-miR398a
Sequence

119 - 

uguguucucaggucgcccccg

 - 139

Get sequence
Deep sequencing32 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).