Stem-loop sequence zma-MIR397b

AccessionMI0013230 (change log)
DescriptionZea mays miR397b stem-loop
Gene family MIPF0000120; MIR397
Literature search

12 open access papers mention zma-MIR397b
(68 sentences)

Stem-loop
   --auc      c         a      a     cgu   ucc 
5'      auugag gcagcguug ugagcc gccgc   gcc   c
        |||||| ||||||||| |||||| |||||   |||   c
3'      uaacuc cgucgcgac acucgg cggcg   cgg   u
   cgcau      a         c      -     --u   cug 
Get sequence
Deep sequencing
2147 reads, 1.77e+03 reads per million, 179 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 84610591-84610674 [-]
intergenic
Database links

Mature sequence zma-miR397b-5p

Accession MIMAT0014019
Previous IDszma-miR397b
Sequence

2 - 

ucauugagcgcagcguugaug

 - 22

Get sequence
Deep sequencing284 reads, 144 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR397b-3p

Accession MIMAT0015353
Previous IDszma-miR397b*
Sequence

63 - 

ccagcgcugcacucaauuacg

 - 83

Get sequence
Deep sequencing29 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).