Stem-loop sequence zma-MIR397a

AccessionMI0013229 (change log)
DescriptionZea mays miR397a stem-loop
Literature search

11 open access papers mention zma-MIR397a
(56 sentences)

Stem-loop
   -  cau       -    uug     g ggagcauguacgucuucccgggcuucacuuucagcuugaacgu 
5'  gu   ugagcgc agcg   augau c                                           g
    ||   ||||||| ||||   ||||| |                                           u
3'  ca   acucgcg uugc   uacua g                                           c
   u  auu       a    cga     a aaauaugauugaguauagguaugaauacuauacguacgugcgu 
Get sequence
Deep sequencing
593 reads, 537 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 183569171-183569313 [-]
intergenic
Database links

Mature sequence zma-miR397a-5p

Accession MIMAT0014018
Previous IDszma-miR397a
Sequence

2 - 

ucauugagcgcagcguugaug

 - 22

Get sequence
Deep sequencing267 reads, 129 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR397a-3p

Accession MIMAT0015352
Previous IDszma-miR397a*
Sequence

122 - 

uagccguuagcgcucauuaacu

 - 143

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).