Stem-loop sequence zma-MIR396h

AccessionMI0013228 (change log)
DescriptionZea mays miR396h stem-loop
Gene family MIPF0000047; MIR396
Literature search

23 open access papers mention zma-MIR396h
(77 sentences)

Stem-loop
   -------------------------uuc          a           gcaccugcugaugcggguggagg 
5'                             ccacagcuuu uugaacugcau                       a
                               |||||||||| |||||||||||                       g
3'                             ggugucgaaa aacuugacgua                       u
   cauuagucuaccggaagaaacacuagaa          g           gagagucuccucgccgucgaagu 
Get sequence
Deep sequencing
745 reads, 548 reads per million, 142 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr9: 15122758-15122881 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR396h
zma-MIR396bchr9: 15122740-15122875 [-]
zma-MIR396hchr9: 15122758-15122881 [+]
Database links

Mature sequence zma-miR396h

Accession MIMAT0014017
Sequence

2 - 

ucccacagcuuuauugaacug

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).