Stem-loop sequence zma-MIR396g

AccessionMI0013227 (change log)
DescriptionZea mays miR396g stem-loop
Gene family MIPF0000047; MIR396
Literature search

23 open access papers mention zma-MIR396g
(77 sentences)

Stem-loop
   --uuc          a         cc  u   u   uuggaucaauugaaacucga 
5'      ccacagcuuu uugaacugc  uc ugc ugc                    u
        |||||||||| |||||||||  || ||| |||                    c
3'      ggugucgaaa aacuugacg  ag acg acg                    a
   uagaa          g         -u  u   u   ucguccgacacgacaccugg 
Get sequence
Deep sequencing
278 reads, 788 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 220222148-220222261 [+]
intergenic
Database links

Mature sequence zma-miR396g-5p

Accession MIMAT0014016
Previous IDszma-miR396g
Sequence

2 - 

ucccacagcuuuauugaacug

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR396g-3p

Accession MIMAT0015351
Previous IDszma-miR396g*
Sequence

93 - 

guucaagaaagcuguggaaga

 - 113

Get sequence
Deep sequencing239 reads, 7 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).