Stem-loop sequence zma-MIR396f

AccessionMI0013226 (change log)
DescriptionZea mays miR396f stem-loop
Gene family MIPF0000047; MIR396
Literature search

22 open access papers mention zma-MIR396f
(76 sentences)

Stem-loop
   --                  a    u     uucuucucucuuggaacggcagcuuuc 
5'   uuuccacagcuuucuuga cuuc ucuuc                           u
     |||||||||||||||||| |||| |||||                           u
3'   aagggugucgaaagaacu gaag agaag                           c
   ag                  g    c     ccucuacucucucucucucugucuaag 
Get sequence
Deep sequencing
1110 reads, 417 reads per million, 128 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 220211653-220211769 [+]
intergenic
Database links

Mature sequence zma-miR396f-5p

Accession MIMAT0014015
Previous IDszma-miR396f
Sequence

2 - 

uuccacagcuuucuugaacuu

 - 22

Get sequence
Deep sequencing824 reads, 113 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR396f-3p

Accession MIMAT0015350
Previous IDszma-miR396f*
Sequence

96 - 

ggucaagaaagcugugggaag

 - 116

Get sequence
Deep sequencing262 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).