Stem-loop sequence zma-MIR396e

AccessionMI0013225 (change log)
DescriptionZea mays miR396e stem-loop
Gene family MIPF0000047; MIR396
Literature search

22 open access papers mention zma-MIR396e
(77 sentences)

Stem-loop
   --       a          a       uucuucucucucuuagaagggccguauagcuucuuugaaccucucucucucucuc 
5'   uuuccac gcuuucuuga cuucuuc                                                       u
     ||||||| |||||||||| |||||||                                                        
3'   aagggug cgaaagaacu gaagaag                                                       c
   ag       c          g       ccucuagucucucgcucuccgucucuuacuucuuucacaagcacaugugaaaacu 
Get sequence
Deep sequencing
1445 reads, 748 reads per million, 143 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 176331864-176332029 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR396e
zma-MIR396echr4: 176331864-176332029 [-]
zma-MIR396achr4: 176326883-176327019 [+]
Database links

Mature sequence zma-miR396e-5p

Accession MIMAT0014014
Previous IDszma-miR396e
Sequence

2 - 

uuccacagcuuucuugaacuu

 - 22

Get sequence
Deep sequencing824 reads, 113 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR396e-3p

Accession MIMAT0015349
Previous IDszma-miR396e*
Sequence

145 - 

ggucaagaaagccgugggaag

 - 165

Get sequence
Deep sequencing357 reads, 111 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).