Stem-loop sequence zma-MIR395p

AccessionMI0013224 (change log)
DescriptionZea mays miR395p stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395p
(84 sentences)

Stem-loop
   --        u              gag    -cau  --     ac 
5'   aguucccu caagcacuucacau   gcac    uc  aaaug  a
     |||||||| ||||||||||||||   ||||    ||  |||||  a
3'   ucaagggg guuugugaagugua   ugug    ag  uuuac  c
   uc        -              --a    uauu  aa     cu 
Get sequence
Deep sequencing
51 reads, 988 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 145466402-145466490 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395p
zma-MIR395nchr10: 145465911-145465976 [+]
zma-MIR395ochr10: 145466084-145466309 [+]
zma-MIR395pchr10: 145466402-145466490 [+]
Database links

Mature sequence zma-miR395p-5p

Accession MIMAT0015348
Previous IDszma-miR395p*
Sequence

2 - 

guucccuucaagcacuucacau

 - 23

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR395p-3p

Accession MIMAT0014013
Previous IDszma-miR395p
Sequence

68 - 

gugaaguguuugggggaacuc

 - 88

Get sequence
Deep sequencing33 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).