Stem-loop sequence zma-MIR395o

AccessionMI0013223 (change log)
DescriptionZea mays miR395o stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395o
(85 sentences)

Stem-loop
   -----aguucucuucaagcacuucacgaggcaucacacuga   c   ug           -               u     aucauuugcauuugcuugauguuagucaugca 
5'                                          gag uuu  ugaaguguuug ggggaacucuuggug cacaa                                c
                                            ||| |||  ||||||||||| ||||||||||||||| |||||                                 
3'                                          uuc aga  acuucacgaac ucccuugaggaucau guguu                                c
   ucucaaguggguuugugaaguguuaccgggaaauaauucag   c   gu           a               u     uugcaacgguacaggaaauagaguauagugua 
Get sequence
Deep sequencing
551 reads, 566 reads per million, 148 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 145466084-145466309 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395o
zma-MIR395nchr10: 145465911-145465976 [+]
zma-MIR395ochr10: 145466084-145466309 [+]
zma-MIR395pchr10: 145466402-145466490 [+]
Database links

Mature sequence zma-miR395o-5p

Accession MIMAT0015347
Previous IDszma-miR395o*
Sequence

2 - 

guucucuucaagcacuucacga

 - 23

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR395o-3p

Accession MIMAT0014012
Previous IDszma-miR395o
Sequence

205 - 

gugaaguguuugggugaacuc

 - 225

Get sequence
Deep sequencing70 reads, 16 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).