Stem-loop sequence zma-MIR395n

AccessionMI0013222 (change log)
DescriptionZea mays miR395n stem-loop
Gene family MIPF0000016; MIR395
Literature search

19 open access papers mention zma-MIR395n
(85 sentences)

Stem-loop
   --        a               -    cgu 
5'   aguucucu caagcacuucacgag gcuu   a
     |||||||| ||||||||||||||| ||||    
3'   ucaagggg guuugugaaguguuu cgag   c
   uc        -               u    agu 
Get sequence
Deep sequencing
172 reads, 178 reads per million, 125 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 145465911-145465976 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395n
zma-MIR395nchr10: 145465911-145465976 [+]
zma-MIR395ochr10: 145466084-145466309 [+]
zma-MIR395pchr10: 145466402-145466490 [+]
Database links

Mature sequence zma-miR395n-5p

Accession MIMAT0015346
Previous IDszma-miR395n*
Sequence

2 - 

guucucuacaagcacuucacga

 - 23

Get sequence
Deep sequencing12 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR395n-3p

Accession MIMAT0014011
Previous IDszma-miR395n
Sequence

45 - 

gugaaguguuugggggaacuc

 - 65

Get sequence
Deep sequencing45 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).