Stem-loop sequence zma-MIR395m

AccessionMI0013221 (change log)
DescriptionZea mays miR395m stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395m
(84 sentences)

Stem-loop
   --        u                a cu     uu    g 
5'   aguuccuu caaacacuucacaugg g  ucuca  ggug a
     |||||||| |||||||||||||||| |  |||||  ||||  
3'   ucaaggag guuugugaagugugcc c  agagu  uuau u
   uc        -                - --     uc    a 
Get sequence
Deep sequencing
45 reads, 583 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 78600541-78600622 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395m
zma-MIR395cchr10: 78600687-78600824 [-]
zma-MIR395mchr10: 78600541-78600622 [-]
zma-MIR395lchr10: 78600412-78600492 [-]
zma-MIR395kchr10: 78600241-78600324 [-]
Database links

Mature sequence zma-miR395m-5p

Accession MIMAT0015345
Previous IDszma-miR395m*
Sequence

2 - 

guuccuuucaaacacuucacau

 - 23

Get sequence
Evidence not experimental

Mature sequence zma-miR395m-3p

Accession MIMAT0014010
Previous IDszma-miR395m
Sequence

61 - 

gugaaguguuuggaggaacuc

 - 81

Get sequence
Deep sequencing13 reads, 7 experiments
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).