Stem-loop sequence zma-MIR395l

AccessionMI0013220 (change log)
DescriptionZea mays miR395l stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395l
(86 sentences)

Stem-loop
   --       u             c    aggccaugcacaa 
5'   aguuccu ccaaacacuucac agcu             g
     ||||||| ||||||||||||| ||||              
3'   ucaagga gguuugugaagug ucgg             a
   uc       -             a    auuacacccaagu 
Get sequence
Deep sequencing
129 reads, 161 reads per million, 114 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 78600412-78600492 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395l
zma-MIR395cchr10: 78600687-78600824 [-]
zma-MIR395mchr10: 78600541-78600622 [-]
zma-MIR395lchr10: 78600412-78600492 [-]
zma-MIR395kchr10: 78600241-78600324 [-]
Database links

Mature sequence zma-miR395l-5p

Accession MIMAT0015344
Previous IDszma-miR395l*
Sequence

2 - 

guuccuuccaaacacuucacca

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

Mature sequence zma-miR395l-3p

Accession MIMAT0014009
Previous IDszma-miR395l
Sequence

60 - 

gugaaguguuuggaggaacuc

 - 80

Get sequence
Deep sequencing19 reads, 6 experiments
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).