Stem-loop sequence zma-MIR395k

AccessionMI0013219 (change log)
DescriptionZea mays miR395k stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395k
(84 sentences)

Stem-loop
   --        u             ----------ug    a    gu 
5'   aguuuccu caagcacuucaca            gagc uucu  c
     |||||||| |||||||||||||            |||| ||||  u
3'   ucaaagga guuugugaagugu            uucg aaga  u
   uc        -             uacguuauuuaa    a    ga 
Get sequence
Deep sequencing
47 reads, 473 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 78600241-78600324 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395k
zma-MIR395cchr10: 78600687-78600824 [-]
zma-MIR395mchr10: 78600541-78600622 [-]
zma-MIR395lchr10: 78600412-78600492 [-]
zma-MIR395kchr10: 78600241-78600324 [-]
Database links

Mature sequence zma-miR395k-5p

Accession MIMAT0015343
Previous IDszma-miR395k*
Sequence

2 - 

guuuccuucaagcacuucacau

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental

Mature sequence zma-miR395k-3p

Accession MIMAT0014008
Previous IDszma-miR395k
Sequence

63 - 

gugaaguguuugaggaaacuc

 - 83

Get sequence
Deep sequencing33 reads, 9 experiments
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).