Stem-loop sequence zma-MIR395k

Accession

MI0013219

Description

Zea mays miR395k stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

--        u             ----------ug    a    gu 
  aguuuccu caagcacuucaca            gagc uucu  c
  |||||||| |||||||||||||            |||| ||||  u
  ucaaagga guuugugaagugu            uucg aaga  u
uc        -             uacguuauuuaa    a    ga 

Genome context

• Coordinates (RefGen_v2): chr10: 79171225-79171308 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from zma-MIR395k

• zma-MIR395c: chr10: 79171671-79171808 [-]
• zma-MIR395m: chr10: 79171525-79171606 [-]
• zma-MIR395l: chr10: 79171396-79171476 [-]
• zma-MIR395k: chr10: 79171225-79171308 [-]

Mature sequence zma-miR395k-5p

• Accession: MIMAT0015343
• Previous IDs: zma-miR395k*
• Sequence: 2 - guuuccuucaagcacuucacau - 23
• Evidence: not experimental

Mature sequence zma-miR395k-3p

• Accession: MIMAT0014008
• Previous IDs: zma-miR395k
• Sequence: 63 - gugaaguguuugaggaaacuc - 83
• Evidence: not experimental

References

1. PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).