Stem-loop sequence zma-MIR395j

AccessionMI0013218 (change log)
DescriptionZea mays miR395j stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395j
(84 sentences)

Stem-loop
   --        u              gag     -au  aaauaac 
5'   aguucccu caagcacuucacau   gcacc   uc       a
     |||||||| ||||||||||||||   |||||   ||        
3'   ucaagggg guuugugaagugua   cgugg   ag       c
   uc        -              ---     auu  aacuuua 
Get sequence
Deep sequencing
44 reads, 413 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence zma-miR395j-5p

Accession MIMAT0015342
Previous IDszma-miR395j*
Sequence

2 - 

guucccuucaagcacuucacau

 - 23

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR395j-3p

Accession MIMAT0014007
Previous IDszma-miR395j
Sequence

64 - 

gugaaguguuugggggaacuc

 - 84

Get sequence
Deep sequencing33 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).