Stem-loop sequence zma-MIR395i

AccessionMI0013217 (change log)
DescriptionZea mays miR395i stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395i
(84 sentences)

Stem-loop
   --        a               accu      a 
5'   aguucccu caagcacuucacgau    uggcuu a
     |||||||| |||||||||||||||    |||||| u
3'   ucaagggg guuugugaaguguug    accgga a
   uc        -               ----      a 
Get sequence
Deep sequencing
169 reads, 1.18e+03 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 6286588-6286657 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395i
zma-MIR395achr2: 6288043-6288191 [-]
zma-MIR395bchr2: 6287388-6287501 [-]
zma-MIR395hchr2: 6287229-6287313 [-]
zma-MIR395ichr2: 6286588-6286657 [-]
zma-MIR395echr2: 6286411-6286495 [-]
zma-MIR395gchr2: 6277107-6277172 [-]
zma-MIR395fchr2: 6276947-6277016 [-]
Database links

Mature sequence zma-miR395i-5p

Accession MIMAT0015341
Previous IDszma-miR395i*
Sequence

2 - 

guucccuacaagcacuucacga

 - 23

Get sequence
Deep sequencing28 reads, 8 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR395i-3p

Accession MIMAT0014006
Previous IDszma-miR395i
Sequence

49 - 

gugaaguguuugggggaacuc

 - 69

Get sequence
Deep sequencing138 reads, 119 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).