Stem-loop sequence zma-MIR395i

Accession

MI0013217

Description

Zea mays miR395i stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

--        a               accu      a 
  aguucccu caagcacuucacgau    uggcuu a
  |||||||| |||||||||||||||    |||||| u
  ucaagggg guuugugaaguguug    accgga a
uc        -               ----      a 

Genome context

• Coordinates (RefGen_v2): chr2: 6331942-6332011 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from zma-MIR395i

• zma-MIR395a: chr2: 6333397-6333545 [-]
• zma-MIR395b: chr2: 6332742-6332855 [-]
• zma-MIR395h: chr2: 6332583-6332667 [-]
• zma-MIR395i: chr2: 6331942-6332011 [-]
• zma-MIR395e: chr2: 6331765-6331849 [-]
• zma-MIR395g: chr2: 6322460-6322525 [-]
• zma-MIR395f: chr2: 6322300-6322369 [-]

Mature sequence zma-miR395i-5p

• Accession: MIMAT0015341
• Previous IDs: zma-miR395i*
• Sequence: 2 - guucccuacaagcacuucacga - 23
• Evidence: experimental; Solexa [1]

Mature sequence zma-miR395i-3p

• Accession: MIMAT0014006
• Previous IDs: zma-miR395i
• Sequence: 49 - gugaaguguuugggggaacuc - 69
• Evidence: experimental; Solexa [1]

References

1. PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).