Stem-loop sequence zma-MIR395h

AccessionMI0013216 (change log)
DescriptionZea mays miR395h stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395h
(84 sentences)

Stem-loop
   --        u              gag     -au  aaauaac 
5'   aguucccu caagcacuucacau   gcacc   uc       a
     |||||||| ||||||||||||||   |||||   ||        
3'   ucaagggg guuugugaagugua   cgugg   ag       c
   uc        -              ---     auu  aacuuua 
Get sequence
Deep sequencing
44 reads, 413 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 6287229-6287313 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395h
zma-MIR395achr2: 6288043-6288191 [-]
zma-MIR395bchr2: 6287388-6287501 [-]
zma-MIR395hchr2: 6287229-6287313 [-]
zma-MIR395ichr2: 6286588-6286657 [-]
zma-MIR395echr2: 6286411-6286495 [-]
Database links

Mature sequence zma-miR395h-5p

Accession MIMAT0015340
Previous IDszma-miR395h*
Sequence

2 - 

guucccuucaagcacuucacau

 - 23

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR395h-3p

Accession MIMAT0014005
Previous IDszma-miR395h
Sequence

64 - 

gugaaguguuugggggaacuc

 - 84

Get sequence
Deep sequencing33 reads, 13 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).