Stem-loop sequence zma-MIR395g

AccessionMI0013215 (change log)
DescriptionZea mays miR395g stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395g
(84 sentences)

Stem-loop
   --      aug               -  a  gu 
5'   aguucu   caagcacuucacgag gc uu  u
     ||||||   ||||||||||||||| || ||   
3'   ucaagg   guuugugaaguguuu cg ga  u
   uc      -gg               u  a  ac 
Get sequence
Deep sequencing
172 reads, 191 reads per million, 125 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 6277107-6277172 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395g
zma-MIR395ichr2: 6286588-6286657 [-]
zma-MIR395echr2: 6286411-6286495 [-]
zma-MIR395gchr2: 6277107-6277172 [-]
zma-MIR395fchr2: 6276947-6277016 [-]
zma-MIR395dchr2: 6276291-6276356 [-]
Database links

Mature sequence zma-miR395g-5p

Accession MIMAT0015339
Previous IDszma-miR395g*
Sequence

2 - 

guucuaugcaagcacuucacga

 - 23

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR395g-3p

Accession MIMAT0014004
Previous IDszma-miR395g
Sequence

45 - 

gugaaguguuugggggaacuc

 - 65

Get sequence
Deep sequencing45 reads, 14 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).