Stem-loop sequence zma-MIR395f

AccessionMI0013214 (change log)
DescriptionZea mays miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395f
(87 sentences)

Stem-loop
   --    a  ua       g  u    accu      a 
5'   aguu cc  caagcac uc cgau    uggcuu a
     |||| ||  ||||||| || ||||    |||||| u
3'   ucaa gg  guuugug ag guug    accgga a
   uc    -  gg       a  u    ----      a 
Get sequence
Deep sequencing
165 reads, 1.14e+03 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 6276947-6277016 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395f
zma-MIR395ichr2: 6286588-6286657 [-]
zma-MIR395echr2: 6286411-6286495 [-]
zma-MIR395gchr2: 6277107-6277172 [-]
zma-MIR395fchr2: 6276947-6277016 [-]
zma-MIR395dchr2: 6276291-6276356 [-]
Database links

Mature sequence zma-miR395f-5p

Accession MIMAT0015338
Previous IDszma-miR395f*
Sequence

2 - 

guuaccuacaagcacgucucga

 - 23

Get sequence
Deep sequencing24 reads, 7 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR395f-3p

Accession MIMAT0014003
Previous IDszma-miR395f
Sequence

49 - 

gugaaguguuugggggaacuc

 - 69

Get sequence
Deep sequencing138 reads, 119 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).