Stem-loop sequence zma-MIR393c

AccessionMI0013211 (change log)
DescriptionZea mays miR393c stem-loop
Gene family MIPF0000083; MIR393
Literature search

22 open access papers mention zma-MIR393c
(71 sentences)

Stem-loop
   --c           c        cuaac    ---cga   ac  -  -  g 
5'    uccaaagggau gcauugau     cugc      ucg  gc cg ac u
      ||||||||||| ||||||||     ||||      |||  || || ||  
3'    agguuucccua cgugacug     gacg      agc  cg gc ug a
   uua           a        -acua    aacagg   -c  u  a  c 
Get sequence
Deep sequencing
1337 reads, 1.15e+03 reads per million, 159 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 149451810-149451906 [-]
intergenic
Database links

Mature sequence zma-miR393c-5p

Accession MIMAT0014000
Previous IDszma-miR393c
Sequence

2 - 

uccaaagggaucgcauugaucu

 - 23

Get sequence
Deep sequencing458 reads, 135 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR393c-3p

Accession MIMAT0015335
Previous IDszma-miR393c*
Sequence

75 - 

gucagugcaaucccuuuggaau

 - 96

Get sequence
Deep sequencing445 reads, 35 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).