Stem-loop sequence zma-MIR393b

AccessionMI0013210 (change log)
DescriptionZea mays miR393b stem-loop
Gene family MIPF0000083; MIR393
Literature search

20 open access papers mention zma-MIR393b
(72 sentences)

Stem-loop
   --g                         auuccuuccauuuuuucaugcauggc 
5'    uccaaagggaucgcauugauccauc                          u
      |||||||||||||||||||||||||                           
3'    agguuuuccuagcguaacuagguag                          g
   cgg                         cuguucaggaacgucugcugcuucug 
Get sequence
Deep sequencing
980 reads, 765 reads per million, 150 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 17997197-17997304 [+]
intergenic
Database links

Mature sequence zma-miR393b-5p

Accession MIMAT0013999
Previous IDszma-miR393b
Sequence

2 - 

uccaaagggaucgcauugaucc

 - 23

Get sequence
Deep sequencing457 reads, 138 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR393b-3p

Accession MIMAT0015334
Previous IDszma-miR393b*
Sequence

86 - 

aucaaugcgauccuuuuggagg

 - 107

Get sequence
Deep sequencing269 reads, 111 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).