Stem-loop sequence zma-MIR390a

AccessionMI0013209 (change log)
DescriptionZea mays miR390a stem-loop
Gene family MIPF0000101; MIR390
Literature search

14 open access papers mention zma-MIR390a
(100 sentences)

Stem-loop
   -- a         g         cua   aaacac     u        -   --gc        --a     --        ga      u   g 
5'   g agcucagga ggauagcgc   gga      auaga cggagccg gcc    gaggagaa   gaaag  agccaaga  uaugug gau a
     | ||||||||| |||||||||   |||      ||||| |||||||| |||    ||||||||   |||||  ||||||||  |||||| ||| a
3'   c ucgaguccu ucuaucgcg   ucu      uaucu gucuuggu cgg    cuccucuu   uuuuc  ucgguucu  guacau cua u
   ca c         a         aag   ---aac     -        g   aggu        gug     ga        ag      -   a 
Get sequence
Deep sequencing
1299 reads, 366 reads per million, 147 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 298107396-298107576 [+]
intergenic
Database links

Mature sequence zma-miR390a-5p

Accession MIMAT0013998
Previous IDszma-miR390a
Sequence

2 - 

aagcucaggagggauagcgcc

 - 22

Get sequence
Deep sequencing1075 reads, 116 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR390a-3p

Accession MIMAT0015333
Previous IDszma-miR390a*
Sequence

160 - 

cgcuaucuauccugagcucca

 - 180

Get sequence
Deep sequencing124 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).