Stem-loop sequence zma-MIR171n

AccessionMI0013208 (change log)
DescriptionZea mays miR171n stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

20 open access papers mention zma-MIR171n
(57 sentences)

Stem-loop
   --         a         c      a         a 
5'   auauuggug gguucaauc gauguu gguuuuaca a
     ||||||||| ||||||||| |||||| ||||||||| a
3'   uauaaccgc ccgaguuag cuauga cuaaaaugu g
   uc         g         u      -         c 
Get sequence
Deep sequencing
2226 reads, 414 reads per million, 137 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr9: 100082921-100082998 [-]
intergenic
Database links

Mature sequence zma-miR171n-5p

Accession MIMAT0015332
Previous IDszma-miR171n*
Sequence

2 - 

uauuggugagguucaauccga

 - 22

Get sequence
Deep sequencing11 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR171n-3p

Accession MIMAT0013997
Previous IDszma-miR171n
Sequence

57 - 

ugauugagccgcgccaauauc

 - 77

Get sequence
Deep sequencing2198 reads, 130 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).