Stem-loop sequence zma-MIR171m

AccessionMI0013207 (change log)
DescriptionZea mays miR171m stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

19 open access papers mention zma-MIR171m
(50 sentences)

Stem-loop
   --           c          ag         aua au 
5'   guauuggcgcg cucaauccga  gcguggcug   g  u
     ||||||||||| ||||||||||  |||||||||   |  g
3'   uauaacugcgc gaguuagguu  uguaccgac   c  g
   uc           c          cu         -gg gc 
Get sequence
Deep sequencing
2797 reads, 2.28e+03 reads per million, 189 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 20785928-20786009 [-]
intergenic
Database links

Mature sequence zma-miR171m-5p

Accession MIMAT0015331
Previous IDszma-miR171m*
Sequence

2 - 

uauuggcgcgccucaauccga

 - 22

Get sequence
Deep sequencing111 reads, 38 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR171m-3p

Accession MIMAT0013996
Previous IDszma-miR171m
Sequence

61 - 

ggauugagccgcgucaauauc

 - 81

Get sequence
Deep sequencing462 reads, 21 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).