Stem-loop sequence zma-MIR171l

AccessionMI0013206 (change log)
DescriptionZea mays miR171l stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

19 open access papers mention zma-MIR171l
(50 sentences)

Stem-loop
   --           c          ag         a     
5'   guauuggcgug cucaauccga  gcguggcug cugg 
     ||||||||||| ||||||||||  ||||||||| ||| c
3'   uauaacugcgc gaguuagguu  uguaccgac ggcg 
   uc           c          cu         -     
Get sequence
Deep sequencing
2154 reads, 1.61e+03 reads per million, 184 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 249547375-249547452 [+]
intergenic
Database links

Mature sequence zma-miR171l-5p

Accession MIMAT0015330
Previous IDszma-miR171l*
Sequence

2 - 

uauuggcgugccucaauccga

 - 22

Get sequence
Deep sequencing18 reads, 10 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR171l-3p

Accession MIMAT0013995
Previous IDszma-miR171l
Sequence

57 - 

ggauugagccgcgucaauauc

 - 77

Get sequence
Deep sequencing462 reads, 21 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).