Stem-loop sequence zma-MIR169r

AccessionMI0013205 (change log)
DescriptionZea mays miR169r stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

30 open access papers mention zma-MIR169r
(219 sentences)

Stem-loop
   -- c         ug          uauuuu a    -     u  cag   ag  --ua g   u 
5'   g agccaagga  acuugccggg      g gcau gcaug ua   ggg  ca    u caa c
     | |||||||||  ||||||||||      | |||| ||||| ||   |||  ||    | ||| u
3'   c ucgguuccu  ugaacggccu      c cgug cgugc au   ccc  gu    a guu g
   ua a         gu          -ucugu -    g     c  --a   ga  uuua g   u 
Get sequence
Deep sequencing
1519 reads, 731 reads per million, 161 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr9: 111791259-111791384 [-]
intergenic
Database links

Mature sequence zma-miR169r-5p

Accession MIMAT0013994
Previous IDszma-miR169r
Sequence

2 - 

cagccaaggaugacuugccgg

 - 22

Get sequence
Deep sequencing921 reads, 28 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR169r-3p

Accession MIMAT0015329
Previous IDszma-miR169r*
Sequence

105 - 

ggcaaguuguccuuggcuaca

 - 125

Get sequence
Deep sequencing13 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).