Stem-loop sequence zma-MIR169q

AccessionMI0013204 (change log)
DescriptionZea mays miR169q stem-loop
Gene family MIPF0000832; MIR169_5
Literature search

31 open access papers mention zma-MIR169q
(215 sentences)

Stem-loop
   --       a   u        u   -     u    g      -  ucuu    g 
5'   uuagcca gaa ggcuugcc auc uccau auuu guccau cu    ggga a
     ||||||| ||| |||||||| ||| ||||| |||| |||||| ||    ||||  
3'   aaucggu cuu ccggacgg ugg aggug uaag uaggug gg    cccu c
   ug       -   -        -   u     -    g      u  uacu    c 
Get sequence
Deep sequencing
764 reads, 744 reads per million, 156 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 130375286-130375391 [+]
intergenic
Database links

Mature sequence zma-miR169q-5p

Accession MIMAT0013993
Previous IDszma-miR169q
Sequence

2 - 

uagccaagaauggcuugccua

 - 22

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR169q-3p

Accession MIMAT0015328
Previous IDszma-miR169q*
Sequence

87 - 

ggcaggccuucuggcuaag

 - 105

Get sequence
Deep sequencing239 reads, 123 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).