Stem-loop sequence zma-MIR169p

AccessionMI0013203 (change log)
DescriptionZea mays miR169p stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

30 open access papers mention zma-MIR169p
(218 sentences)

Stem-loop
   --      aa               auua  u 
5'   guagcc  ggaugacuugccggc    ua u
     ||||||  |||||||||||||||    || u
3'   caucgg  ucuacugaacggccg    gu c
   cg      gg               cccg  u 
Get sequence
Deep sequencing
2716 reads, 1.66e+03 reads per million, 172 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 114375728-114375792 [-]
intergenic
Database links

Mature sequence zma-miR169p-5p

Accession MIMAT0013992
Previous IDszma-miR169p
Sequence

2 - 

uagccaaggaugacuugccgg

 - 22

Get sequence
Deep sequencing1019 reads, 127 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR169p-3p

Accession MIMAT0015327
Previous IDszma-miR169p*
Sequence

44 - 

ggcaagucaucuggggcuacg

 - 64

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).