Stem-loop sequence zma-MIR169o

AccessionMI0013202 (change log)
DescriptionZea mays miR169o stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

32 open access papers mention zma-MIR169o
(219 sentences)

Stem-loop
   --------------------guagccaagaaugacuugccu  g      -------   - g   -    uu     c g  g 
5'                                          au cacgcc       cuc u uug gcag  ccguc g ca c
                                            || ||||||       ||| | ||| ||||  ||||| | ||  
3'                                          ua gugcgg       gag g aac cguu  ggcag c gu c
   accgaucgguucuucuggacggcuacgucgguguaacguag  g      cguuuuu   u g   a    --     - g  a 
Get sequence
Deep sequencing
1636 reads, 1.25e+03 reads per million, 171 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 13818178-13818315 [+]
intergenic
Database links

Mature sequence zma-miR169o-5p

Accession MIMAT0013991
Previous IDszma-miR169o
Sequence

2 - 

uagccaagaaugacuugccua

 - 22

Get sequence
Deep sequencing311 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR169o-3p

Accession MIMAT0015326
Previous IDszma-miR169o*
Sequence

117 - 

ggcaggucuucuuggcuagc

 - 136

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).