Stem-loop sequence zma-MIR169n

AccessionMI0013201 (change log)
DescriptionZea mays miR169n stem-loop
Gene family MIPF0000832; MIR169_5
Literature search

31 open access papers mention zma-MIR169n
(217 sentences)

Stem-loop
   --           u        u   -     --u  uug uu    - ug  ag 
5'   uuagccaagaa ggcuugcc auc uccac   gu   g  cguc u  gg  a
     ||||||||||| |||||||| ||| |||||   ||   |  |||| |  ||  c
3'   aaucgguucuu ccggacgg uag aggug   ca   u  guag a  cc  c
   cg           -        -   u     ugu  -ug gg    u gu  ca 
Get sequence
Deep sequencing
248 reads, 323 reads per million, 149 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 233919759-233919862 [+]
intergenic
Database links

Mature sequence zma-miR169n-5p

Accession MIMAT0013990
Previous IDszma-miR169n
Sequence

2 - 

uagccaagaauggcuugccua

 - 22

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR169n-3p

Accession MIMAT0015325
Previous IDszma-miR169n*
Sequence

84 - 

ggcaggccuucuuggcuaag

 - 103

Get sequence
Deep sequencing16 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).