Stem-loop sequence zma-MIR169m

AccessionMI0013200 (change log)
DescriptionZea mays miR169m stem-loop
Gene family MIPF0000832; MIR169_5
Literature search

30 open access papers mention zma-MIR169m
(215 sentences)

Stem-loop
   --              cu    u   -     u    ug        a    g 
5'   uuagccaagaaugg  ugcc auc uccau auuu  uucaucgc ggaa c
     ||||||||||||||  |||| ||| ||||| ||||  |||||||| ||||  
3'   aaucgguucuuacc  acgg uag aggug uaaa  agguagug ccuu c
   ug              -u    -   u     -    gu        -    c 
Get sequence
Deep sequencing
239 reads, 664 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 102365461-102365561 [+]
intergenic
Database links

Mature sequence zma-miR169m-5p

Accession MIMAT0013989
Previous IDszma-miR169m
Sequence

2 - 

uagccaagaauggcuugccua

 - 22

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR169m-3p

Accession MIMAT0015324
Previous IDszma-miR169m*
Sequence

81 - 

ggcauccauucuuggcuaag

 - 100

Get sequence
Deep sequencing18 reads, 4 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).