Stem-loop sequence zma-MIR169l

AccessionMI0013199 (change log)
DescriptionZea mays miR169l stem-loop
Literature search

32 open access papers mention zma-MIR169l
(226 sentences)

Stem-loop
   --     c                   uuccu    uu  ca   caa 
5'   guagc agggaugauuugccugugg     gucg  gc  ugc   u
     ||||| |||||||||||||||||||     ||||  ||  |||    
3'   caucg ucccuacuaaacgggcauc     uagc  ug  aug   g
   gc     -                   -----    -u  uc   ucc 
Get sequence
Deep sequencing
28 reads, 531 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 303772025-303772113 [+]
intergenic
Database links

Mature sequence zma-miR169l-5p

Accession MIMAT0013988
Previous IDszma-miR169l
Sequence

2 - 

uagccagggaugauuugccug

 - 22

Get sequence
Deep sequencing14 reads, 7 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR169l-3p

Accession MIMAT0015323
Previous IDszma-miR169l*
Sequence

69 - 

ggcaaaucaucccugcuacc

 - 88

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).