Stem-loop sequence zma-MIR167j

AccessionMI0013198 (change log)
DescriptionZea mays miR167j stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

31 open access papers mention zma-MIR167j
(129 sentences)

Stem-loop
   --            g          aa  aua  u      --   uuc   --   ga 
5'   augaagcugcca caugaucuga  cc   cg guucuu  uga   cca  ucu  a
     |||||||||||| ||||||||||  ||   || ||||||  |||   |||  |||   
3'   uacuuugacggu guacuagacu  gg   gc caagag  acu   ggu  aga  g
   uu            -          --  -ca  -      gu   uuc   ug   aa 
Get sequence
Deep sequencing
24622 reads, 1.7e+03 reads per million, 138 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 12791799-12791907 [+]
intergenic
Database links

Mature sequence zma-miR167j-5p

Accession MIMAT0013987
Previous IDszma-miR167j
Sequence

2 - 

ugaagcugccagcaugaucug

 - 22

Get sequence
Deep sequencing24044 reads, 22 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR167j-3p

Accession MIMAT0015322
Previous IDszma-miR167j*
Sequence

89 - 

gaucauguggcaguuucauu

 - 108

Get sequence
Deep sequencing161 reads, 107 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).