Stem-loop sequence zma-MIR166n

AccessionMI0013197 (change log)
DescriptionZea mays miR166n stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166n
(205 sentences)

Stem-loop
   --       uu      cu  gu            -  y   cuug   g 
5'   gggauug  gucugg  cg  gucuccggucga ga ggc    ccg c
     |||||||  ||||||  ||  |||||||||||| || |||    |||  
3'   cccuaac  cggacc  gc  uagaggccagcu cu ucg    ggc g
   uu       uu      ag  uc            g  g   ---a   c 
Get sequence
Deep sequencing
140763 reads, 8.12e+03 reads per million, 177 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 181112182-181112277 [+]
intergenic
Database links

Mature sequence zma-miR166n-5p

Accession MIMAT0015321
Previous IDszma-miR166n*
Sequence

2 - 

ggauuguugucuggcucggug

 - 22

Get sequence
Deep sequencing355 reads, 119 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR166n-3p

Accession MIMAT0013986
Previous IDszma-miR166n
Sequence

75 - 

ucggaccaggcuucaaucccu

 - 95

Get sequence
Deep sequencing139953 reads, 56 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).