Stem-loop sequence zma-MIR164h

AccessionMI0013196 (change log)
DescriptionZea mays miR164h stem-loop
Gene family MIPF0000045; MIR164
Literature search

29 open access papers mention zma-MIR164h
(205 sentences)

Stem-loop
   --         c            aauucauu   u -      -   u     --   gacucacgcaucgccggcgcggcgagcugagcgcgugacacggaaagcagguccgcc 
5'   guggagaag agggcacgugug        cgu c caucga cgg cuggc  gcc                                                         g
     ||||||||| ||||||||||||        ||| | |||||| ||| |||||  |||                                                          
3'   uaccucuuc ucccguguacgu        gcg g guagcu gcc ggccg  cgg                                                         c
   gc         u            --------   u c      a   -     ac   accgaaacgaagcaccucgaugucaaucggccagcuagccggucgcgcccgcggccg 
Get sequence
Deep sequencing
67515 reads, 4.94e+04 reads per million, 212 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 121773384-121773602 [+]
intergenic
Database links

Mature sequence zma-miR164h-5p

Accession MIMAT0013985
Previous IDszma-miR164h
Sequence

2 - 

uggagaagcagggcacgugug

 - 22

Get sequence
Deep sequencing4042 reads, 126 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR164h-3p

Accession MIMAT0015320
Previous IDszma-miR164h*
Sequence

198 - 

caugugcccuucuucuccauc

 - 218

Get sequence
Deep sequencing312 reads, 104 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).