Stem-loop sequence zma-MIR164g

AccessionMI0013195 (change log)
DescriptionZea mays miR164g stem-loop
Gene family MIPF0000045; MIR164
Literature search

28 open access papers mention zma-MIR164g
(199 sentences)

Stem-loop
   --u        ca            a  cacgcc     --     cgccgccgaucuaccgaccucccaaaccugccuuaugguguggg 
5'    uggagaag  gggcacgugcag ga      ggagc  acggc                                            g
      ||||||||  |||||||||||| ||      |||||  |||||                                             
3'    accucuuc  cucgugcacguc cu      ccucg  uguug                                            g
   acc        cc            -  ------     au     uagcuucguuguugcugucgauagcgaagguggcugcuggaggu 
Get sequence
Deep sequencing
4942 reads, 1.26e+03 reads per million, 188 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 142646355-142646525 [-]
intergenic
Database links

Mature sequence zma-miR164g-5p

Accession MIMAT0013984
Previous IDszma-miR164g
Sequence

2 - 

uggagaagcagggcacgugca

 - 22

Get sequence
Deep sequencing3857 reads, 21 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR164g-3p

Accession MIMAT0015319
Previous IDszma-miR164g*
Sequence

150 - 

cacgugcuccccuucuccacc

 - 170

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).