Stem-loop sequence zma-MIR164f

AccessionMI0013194 (change log)
DescriptionZea mays miR164f stem-loop
Gene family MIPF0000045; MIR164
Literature search

29 open access papers mention zma-MIR164f
(203 sentences)

Stem-loop
   --c        c  g         -  c    -aa  -  ----a    u    g a 
5'    uggagaag ag gcacgugcu cg cgac   gu cg     agcc uagg c g
      |||||||| || ||||||||| || ||||   || ||     |||| |||| | c
3'    accucuuc uc cgugcacga gc gcug   ca gc     ucgg gucc g u
   aca        c  g         c  u    gug  u  gcacg    u    g u 
Get sequence
Deep sequencing
5417 reads, 1.57e+03 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 179535508-179535615 [+]
intergenic
Database links

Mature sequence zma-miR164f-5p

Accession MIMAT0013983
Previous IDszma-miR164f
Sequence

2 - 

uggagaagcagggcacgugcu

 - 22

Get sequence
Deep sequencing3844 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR164f-3p

Accession MIMAT0015318
Previous IDszma-miR164f*
Sequence

87 - 

cacgugcgcuccuucuccaac

 - 107

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).