Stem-loop sequence zma-MIR164e

AccessionMI0013193 (change log)
DescriptionZea mays miR164e stem-loop
Gene family MIPF0000045; MIR164
Literature search

28 open access papers mention zma-MIR164e
(203 sentences)

Stem-loop
   --       -a  a                      uuc    --c       cuc   g 
5'   guggaga  gc ggacacgugagcgaccauccag   cacu   ccgcugg   gcu c
     |||||||  || ||||||||||||||||||||||   ||||   |||||||   ||| u
3'   caccucu  cg ccuguguacuugcugguggguu   gugg   ggcggcc   cga g
   gc       cc  -                      uga    uuc       -cu   g 
Get sequence
Deep sequencing
10898 reads, 5.66e+03 reads per million, 193 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 47137796-47137911 [+]
intergenic
Database links

Mature sequence zma-miR164e-5p

Accession MIMAT0013982
Previous IDszma-miR164e
Sequence

2 - 

uggagaagcaggacacgugag

 - 22

Get sequence
Deep sequencing3884 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence zma-miR164e-3p

Accession MIMAT0015317
Previous IDszma-miR164e*
Sequence

95 - 

cauguguccgcccucuccacc

 - 115

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).