Stem-loop sequence zma-MIR160g

AccessionMI0013192 (change log)
DescriptionZea mays miR160g stem-loop
Gene family MIPF0000032; MIR160
Literature search

21 open access papers mention zma-MIR160g
(72 sentences)

Stem-loop
   --    c       c          a   -   gc    c cgu 
5'   augc uggcucc uguaugccac cau gua  ccaa c   g
     |||| ||||||| |||||||||| ||| |||  |||| |    
3'   uacg accgagg acgugcggug gug cgu  gguu g   a
   ug    a       a          g   u   -a    a ugu 
Get sequence
Deep sequencing
1995 reads, 1.29e+03 reads per million, 148 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 94036699-94036784 [+]
intergenic
Database links

Mature sequence zma-miR160g-5p

Accession MIMAT0013981
Previous IDszma-miR160g
Sequence

2 - 

ugccuggcucccuguaugcca

 - 22

Get sequence
Deep sequencing631 reads, 6 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR160g-3p

Accession MIMAT0015316
Previous IDszma-miR160g*
Sequence

65 - 

gcgugcaaggagccaagcaug

 - 85

Get sequence
Deep sequencing94 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).