Stem-loop sequence zma-MIR159k

AccessionMI0013191 (change log)
DescriptionZea mays miR159k stem-loop
Gene family MIPF0000010; MIR159
Literature search

31 open access papers mention zma-MIR159k
(153 sentences)

Stem-loop
   --  u           a    uaaa        cu  -u   -    a  a  g    u     guuc    ugu         ucagagagagagaagauc 
5'   gg gcucccuucaa ccaa    cggucgau  ga  ggg uggu ca cu cucg ucaug    ccac   cccaucuca                  g
     || ||||||||||| ||||    ||||||||  ||  ||| |||| || || |||| |||||    ||||   |||||||||                   
3'   uc cgagggaaguu gguu    gccaguug  cu  ccc gcua gu ga gagc aguac    ggug   ggguagagu                  u
   cg  u           a    uguc        --  uc   u    c  c  g    c     guuu    uuc         ucguagagagcgagagag 
Get sequence
Deep sequencing
10176 reads, 3.44e+03 reads per million, 199 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 10947058-10947257 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR159k
zma-MIR159kchr8: 10947058-10947257 [+]
zma-MIR159bchr8: 10950933-10951153 [+]
Database links

Mature sequence zma-miR159k-5p

Accession MIMAT0015315
Previous IDszma-miR159k*
Sequence

2 - 

gugcucccuucaaaccaauaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence zma-miR159k-3p

Accession MIMAT0013980
Previous IDszma-miR159k
Sequence

179 - 

uuuggauugaagggagcucug

 - 199

Get sequence
Deep sequencing9378 reads, 190 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).