Stem-loop sequence zma-MIR159j

AccessionMI0013190 (change log)
DescriptionZea mays miR159j stem-loop
Gene family MIPF0000010; MIR159
Literature search

32 open access papers mention zma-MIR159j
(154 sentences)

Stem-loop
   aguuugauucacuagaccugauccccuagacuagacggucuggucuuaag    u           a    uaaa        cu  -u   -   ua     g    u     guuc    ugu         ucagagagagagaagauc 
5'                                                   gcgg gcucccuucaa ccaa    cggucgau  ga  ggg ugg  cagcu cucg ucaug    ccac   cccaucuca                  g
                                                     |||| ||||||||||| ||||    ||||||||  ||  ||| |||  ||||| |||| |||||    ||||   |||||||||                   
3'                                                   cguc cgagggaaguu gguu    gccaguug  cu  ccc gcu  gucga gagc aguac    ggug   ggguagagu                  u
   --------------------------------------------------    u           a    uguc        --  uc   u   cc     g    c     guuu    uuc         ucguagagagcgagagag 
Get sequence
Deep sequencing
10366 reads, 3.58e+03 reads per million, 202 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 10920901-10921152 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR159j
zma-MIR159ichr8: 10912332-10912583 [+]
zma-MIR159jchr8: 10920901-10921152 [+]
Database links

Mature sequence zma-miR159j-5p

Accession MIMAT0015314
Previous IDszma-miR159j*
Sequence

54 - 

gugcucccuucaaaccaauaa

 - 74

Get sequence
Evidence experimental; Illumina [1]

Mature sequence zma-miR159j-3p

Accession MIMAT0013979
Previous IDszma-miR159j
Sequence

231 - 

uuuggauugaagggagcucug

 - 251

Get sequence
Deep sequencing9378 reads, 190 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).