Stem-loop sequence zma-MIR159i

AccessionMI0013189 (change log)
DescriptionZea mays miR159i stem-loop
Gene family MIPF0000010; MIR159
Literature search

31 open access papers mention zma-MIR159i
(154 sentences)

Stem-loop
   aguuugauucacuagaccugauccccuagacuagacggucuggucuuaag    u           a    uaaa        cu  -u   -   ua     g    u     guuc    ugu        aucagagagagagaagauc 
5'                                                   gcgg gcucccuucac ccaa    cggucgau  ga  ggg ugg  cagcu cucg ucaug    ccac   cccaucuc                   a
                                                     |||| ||||||||||| ||||    ||||||||  ||  ||| |||  ||||| |||| |||||    ||||   ||||||||                    
3'                                                   cguc cgagggaagug gguu    gccaguug  cu  ccc gcu  gucga gagc aguac    ggug   ggguagag                   u
   --------------------------------------------------    u           a    uguc        --  uc   u   cc     g    c     guuu    uuc        uucguagagagcgagagag 
Get sequence
Deep sequencing
6890 reads, 1.27e+03 reads per million, 171 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 10912332-10912583 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR159i
zma-MIR159hchr8: 10885935-10886134 [+]
zma-MIR159hchr8: 10908489-10908688 [+]
zma-MIR159ichr8: 10912332-10912583 [+]
zma-MIR159jchr8: 10920901-10921152 [+]
Database links

Mature sequence zma-miR159i-5p

Accession MIMAT0015313
Previous IDszma-miR159i*
Sequence

54 - 

gugcucccuucacaccaauaa

 - 74

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR159i-3p

Accession MIMAT0013978
Previous IDszma-miR159i
Sequence

231 - 

uuuggagugaagggagcucug

 - 251

Get sequence
Deep sequencing6010 reads, 24 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).