Stem-loop sequence zma-MIR159h

AccessionMI0013188 (change log)
DescriptionZea mays miR159h stem-loop
Gene family MIPF0000010; MIR159
Literature search

31 open access papers mention zma-MIR159h
(157 sentences)

Stem-loop
   --  u           a    uaaa        cu  -u   -   ua     g    u     guuc    ugu         ucagagagagagaagauc 
5'   gg gcucccuucac ccaa    cggucgau  ga  ggg ugg  cagcu cucg ucaug    ccac   cccaucuca                  g
     || ||||||||||| ||||    ||||||||  ||  ||| |||  ||||| |||| |||||    ||||   |||||||||                   
3'   uc cgagggaagug gguu    gccaguug  cu  ccc gcu  gucga gagc aguac    ggug   ggguagagu                  u
   cg  u           a    uguc        --  uc   u   cc     g    c     guuu    uuc         ucguagagagcgagagag 
Get sequence
Deep sequencing
6675 reads, 1.1e+03 reads per million, 172 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 10885935-10886134 [+]
intergenic
chr8: 10908489-10908688 [+]
intergenic
Database links

Mature sequence zma-miR159h-5p

Accession MIMAT0015312
Previous IDszma-miR159h*
Sequence

2 - 

gugcucccuucacaccaauaa

 - 22

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR159h-3p

Accession MIMAT0013977
Previous IDszma-miR159h
Sequence

179 - 

uuuggagugaagggagcucug

 - 199

Get sequence
Deep sequencing6010 reads, 24 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).